View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4391_low_3 (Length: 231)
Name: NF4391_low_3
Description: NF4391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4391_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 138 - 220
Target Start/End: Original strand, 38940577 - 38940659
Alignment:
| Q |
138 |
cactcataaccttttgtttaagattgttgatatttagtacttgatatgattaatttttcaccatgatctttgagtataatcta |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38940577 |
cactcataaccttttgtttaagattgttgatatttagtacttgatatgattaatttttcaccatgatctttgagtataatcta |
38940659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 38940459 - 38940519
Alignment:
| Q |
20 |
tcttgtttattgagttttcaaagaatttgattttttaccaggttaattgattaataacaac |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38940459 |
tcttgtttattgagttttcaaagaatttgattttttaccaggttaattgattaataacaac |
38940519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 138 - 182
Target Start/End: Original strand, 38940728 - 38940772
Alignment:
| Q |
138 |
cactcataaccttttgtttaagattgttgatatttagtacttgat |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38940728 |
cactcataaccttttgtttaagattgttgatatctagtacttgat |
38940772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 9)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 144 - 182
Target Start/End: Complemental strand, 55759204 - 55759167
Alignment:
| Q |
144 |
taaccttttgtttaagattgttgatatttagtacttgat |
182 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
55759204 |
taaccttttgttta-gattgttgatatttagtacttgat |
55759167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 221
Target Start/End: Complemental strand, 55757747 - 55757710
Alignment:
| Q |
184 |
tgattaatttttcaccatgatctttgagtataatctac |
221 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
55757747 |
tgattgatttttcaccataatctttgagtataatctac |
55757710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 221
Target Start/End: Complemental strand, 55757921 - 55757884
Alignment:
| Q |
184 |
tgattaatttttcaccatgatctttgagtataatctac |
221 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
55757921 |
tgattgatttttcaccataatctttgagtataatctac |
55757884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 221
Target Start/End: Complemental strand, 55758095 - 55758058
Alignment:
| Q |
184 |
tgattaatttttcaccatgatctttgagtataatctac |
221 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
55758095 |
tgattgatttttcaccataatctttgagtataatctac |
55758058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 221
Target Start/End: Complemental strand, 55758269 - 55758232
Alignment:
| Q |
184 |
tgattaatttttcaccatgatctttgagtataatctac |
221 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
55758269 |
tgattgatttttcaccataatctttgagtataatctac |
55758232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 221
Target Start/End: Complemental strand, 55758443 - 55758406
Alignment:
| Q |
184 |
tgattaatttttcaccatgatctttgagtataatctac |
221 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
55758443 |
tgattgatttttcaccataatctttgagtataatctac |
55758406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 221
Target Start/End: Complemental strand, 55758617 - 55758580
Alignment:
| Q |
184 |
tgattaatttttcaccatgatctttgagtataatctac |
221 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
55758617 |
tgattgatttttcaccataatctttgagtataatctac |
55758580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 221
Target Start/End: Complemental strand, 55758787 - 55758750
Alignment:
| Q |
184 |
tgattaatttttcaccatgatctttgagtataatctac |
221 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
55758787 |
tgattgatttttcaccataatctttgagtataatctac |
55758750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 221
Target Start/End: Complemental strand, 55759135 - 55759098
Alignment:
| Q |
184 |
tgattaatttttcaccatgatctttgagtataatctac |
221 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
55759135 |
tgattgatttttcaccataatctttgagtataatctac |
55759098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University