View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4392-Insertion-4 (Length: 348)

Name: NF4392-Insertion-4
Description: NF4392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4392-Insertion-4
NF4392-Insertion-4
[»] chr1 (3 HSPs)
chr1 (181-342)||(47082804-47082965)
chr1 (8-56)||(47082637-47082685)
chr1 (117-155)||(47082740-47082778)


Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 181 - 342
Target Start/End: Original strand, 47082804 - 47082965
Alignment:
181 ataaggaacgaatttgaattggaaatttggatacccttgagattaaaataaggaaattaatactatagtttatgtttgaattgggctgtacgatgtaaga 280  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47082804 ataaggaacgaatttgaattggaaatttggatacccttgagattaaaataaggaaattaatactatagtttatgtttgaattgggctgtacgatgtaaga 47082903  T
281 gttggtaggaatatgtgtcggggtttggttgtcttagcaatgagaagtcaaagctaggtagc 342  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47082904 gttggtaggaatatgtgtcggggtttggttgtcttagcaatgagaagtcaaagctaggtagc 47082965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 47082637 - 47082685
Alignment:
8 ttactgtgttgtgtaatggagattagtatactcaaacgacagcgttgat 56  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
47082637 ttactgtgttgtgtaatggagattagtatactcaaacgacagcgttgat 47082685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 117 - 155
Target Start/End: Original strand, 47082740 - 47082778
Alignment:
117 aggacgaaaggaatctttttgtacatgatgatagtatag 155  Q
    |||||||||||||||||||||||||||||||||||||||    
47082740 aggacgaaaggaatctttttgtacatgatgatagtatag 47082778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University