View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4392-Insertion-4 (Length: 348)
Name: NF4392-Insertion-4
Description: NF4392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4392-Insertion-4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 181 - 342
Target Start/End: Original strand, 47082804 - 47082965
Alignment:
| Q |
181 |
ataaggaacgaatttgaattggaaatttggatacccttgagattaaaataaggaaattaatactatagtttatgtttgaattgggctgtacgatgtaaga |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47082804 |
ataaggaacgaatttgaattggaaatttggatacccttgagattaaaataaggaaattaatactatagtttatgtttgaattgggctgtacgatgtaaga |
47082903 |
T |
 |
| Q |
281 |
gttggtaggaatatgtgtcggggtttggttgtcttagcaatgagaagtcaaagctaggtagc |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47082904 |
gttggtaggaatatgtgtcggggtttggttgtcttagcaatgagaagtcaaagctaggtagc |
47082965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 47082637 - 47082685
Alignment:
| Q |
8 |
ttactgtgttgtgtaatggagattagtatactcaaacgacagcgttgat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47082637 |
ttactgtgttgtgtaatggagattagtatactcaaacgacagcgttgat |
47082685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 117 - 155
Target Start/End: Original strand, 47082740 - 47082778
Alignment:
| Q |
117 |
aggacgaaaggaatctttttgtacatgatgatagtatag |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47082740 |
aggacgaaaggaatctttttgtacatgatgatagtatag |
47082778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University