View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4392-Insertion-5 (Length: 326)
Name: NF4392-Insertion-5
Description: NF4392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4392-Insertion-5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 7 - 190
Target Start/End: Original strand, 25717315 - 25717498
Alignment:
| Q |
7 |
aaaattacaatgaactccctccaatgttatttaaataggaaaaacatcactatagtttttaattgatcatcaccaaccttaattcattttctttcgatat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25717315 |
aaaattacaatgaactccctccaatgttatttaaataggagaaacatcactatagtttttaattgatcatcaccaaccttaattcattttctttcgatat |
25717414 |
T |
|
| Q |
107 |
atgacatttacttcgttatccgttaactgtgacttgttgtggtttggtttataaaagaactcacagtttgcatcccaaagaagc |
190 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
25717415 |
atgacatttacttcgttatccgttaattgtgacttgttgtggtttggtttataaaagaactcactgtttggatcccaaagaagc |
25717498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 183 - 267
Target Start/End: Original strand, 25717516 - 25717600
Alignment:
| Q |
183 |
aaagaagccatcaaggaaagaaggacatagatttctcttttcactctttcattgtggtaagttctttcatgtccatgtccatgtc |
267 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
25717516 |
aaagaagccatcaaggaaaggaagacatagatttctcttttcactctttcattgtggtaagttctttcatgttcatgtctatgtc |
25717600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University