View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4392_low_8 (Length: 227)
Name: NF4392_low_8
Description: NF4392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4392_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 216
Target Start/End: Complemental strand, 32989607 - 32989408
Alignment:
| Q |
17 |
agttgtggcatcttgaaccgtaacagtggggccctctatgtatgttttgaaggtgctgaggaactgccaggtggtggtggatccaaatatggaactagta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32989607 |
agttgtggcatcttgaaccgtaacagtggggccctctatgtatgttttgaaggtgctgaggaacttccaggtggtggtggatccaaatatggaactagta |
32989508 |
T |
 |
| Q |
117 |
tcacaagggaggttgcattggatccttcccgtgatatcattcttgcatatatgcaaaacggtgacgttttaacaccagatcatggttttcctgttagaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32989507 |
tcacaagggaggttgcattggatccttcccgtgatatcattcttgcatatatgcaaaacggtgacgttttaacaccagatcatggttttcctgttagaat |
32989408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 32961943 - 32961751
Alignment:
| Q |
18 |
gttgtggcatcttgaaccgtaacagtggggccctctatgtatgttttgaaggtgctgaggaactgccaggtggtggtggatccaaatatggaactagtat |
117 |
Q |
| |
|
||||||| || || |||||||| |||||||||||||||||||| |||||||||||||||||||| |||||||||||||| || ||||||||||||||||| |
|
|
| T |
32961943 |
gttgtggaatatttaaccgtaaaagtggggccctctatgtatgctttgaaggtgctgaggaacttccaggtggtggtggttcaaaatatggaactagtat |
32961844 |
T |
 |
| Q |
118 |
cacaagggaggttgcattggatccttcccgtgatatcattcttgcatatatgcaaaacggtgacgttttaacaccagatcatggttttcctgt |
210 |
Q |
| |
|
| || |||||||||||||||| | | ||||||||| | || ||||||||||| ||||| |||||| | || ||||| ||||||||||| |
|
|
| T |
32961843 |
cctcagcgaggttgcattggatcgcactagcgatatcattttggcgtatatgcaaaatggtgaggttttagctcctgatcacggttttcctgt |
32961751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University