View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4393_low_3 (Length: 358)
Name: NF4393_low_3
Description: NF4393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4393_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 87 - 340
Target Start/End: Complemental strand, 22700419 - 22700166
Alignment:
| Q |
87 |
taagataaagtttagaggaatttgaggaacaacaccatttgataacaagggtgtgaattggaatgcaaagaggtgaaatgaagcttgatgaagatcttga |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22700419 |
taagataaagtttagaggaatttgaggaacaacaccatttgataacaagggtgtgaattggaatgcaaagaggtgaaatgaagcttgatgaagatcttga |
22700320 |
T |
|
| Q |
187 |
tcacaaacttgaccgtgaagatgattttcagacggatgatgaagaaaatcaagcagatagggattttaaaaatcaaatggatgatgatgataccgaatca |
286 |
Q |
| |
|
||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22700319 |
tcataaacttgaccgtgaagatgattttcaaacggatgatgaagaaaatcaagcagatagggattttaaaaatcaaatggatgatgatgataccgaatca |
22700220 |
T |
|
| Q |
287 |
tcagataataagaattcacctccttcaagatatttatcaaatgaggttgatttt |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22700219 |
tcagataataagaattcacctccttcaagatattcatcaaatgaggttgatttt |
22700166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University