View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4393_low_6 (Length: 240)
Name: NF4393_low_6
Description: NF4393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4393_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 31 - 235
Target Start/End: Original strand, 18541793 - 18541998
Alignment:
| Q |
31 |
gcaatgcaatctgcttagttttcgaaaac-tatgcaaaatatttatactgtgataatcaagaataattcactaaagttctttgatagaaatcaaatgtta |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18541793 |
gcaatgcaatctgcttagttttcgaaaacatatgcaaaatgtttatactgtgataatgaagaataattcactaaagttctttgatagaaatcaaatgtta |
18541892 |
T |
 |
| Q |
130 |
atgtggaaatctccttttgcaaagaatagaaccatttaagctggcatgaagactgcaaagatgagctgcttatttgcaaataccagtaaagatgaaagct |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| | ||| |||||||||||||||||||||||||||| |
|
|
| T |
18541893 |
atgtggaaatctccttttgcaaagaatagaaccattcaagctagcatgaagactgcaaagatgagatacttgtttgcaaataccagtaaagatgaaagct |
18541992 |
T |
 |
| Q |
230 |
agctaa |
235 |
Q |
| |
|
|||||| |
|
|
| T |
18541993 |
agctaa |
18541998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University