View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4395_low_2 (Length: 233)
Name: NF4395_low_2
Description: NF4395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4395_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 92; Significance: 8e-45; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 81 - 209
Target Start/End: Complemental strand, 3002717 - 3002590
Alignment:
| Q |
81 |
tatcatatatagcttttcacaactcagtttagcagaattgaaaataaatcatatgttgaatttatttttcaactgtccannnnnnnncagtagtttggag |
180 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3002717 |
tatcaaatatagcttttcacaactcagtttagcagaattgaaaataaatcatatgttgaatttatttttcaactgtcca-attttttcagtagtttggac |
3002619 |
T |
|
| Q |
181 |
tttggagcaagactctaaaatggcttggg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3002618 |
tttggagcaagactctaaaatggcttggg |
3002590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 89 - 159
Target Start/End: Complemental strand, 3010972 - 3010902
Alignment:
| Q |
89 |
atagcttttcacaactcagtttagcagaattgaaaataaatcatatgttgaatttatttttcaactgtcca |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
3010972 |
atagcttttcacaactcagtttagcagaattgaaaataaatcatatgttgaatttatttctcaacggtcca |
3010902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 212
Target Start/End: Complemental strand, 3010892 - 3010860
Alignment:
| Q |
180 |
gtttggagcaagactctaaaatggcttgggatt |
212 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
3010892 |
gtttggagcaagactctgaaatggcttgggatt |
3010860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University