View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4397_high_11 (Length: 275)
Name: NF4397_high_11
Description: NF4397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4397_high_11 |
 | |
|
| [»] scaffold0024 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 76761 - 76872
Alignment:
| Q |
1 |
ccatacagcacttgattttttgcttgtcgatgaaatctttctctgaaccaaatgcaattcttaactttcccatatagctcatgatcgttactgtgagact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
76761 |
ccatacagcacttgattttttgcttgtcaatgaaatctttctctgaaccaaatgcaattcttaactttcccatatagctcatgatcgttactgtgagact |
76860 |
T |
|
| Q |
101 |
ctgcaattccac |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
76861 |
ctgcaattccac |
76872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 76926 - 76976
Alignment:
| Q |
166 |
taatcgtcaattttgtccctaaacttctctagcaatcgaacaaattgatac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
76926 |
taatcgtcaattttgtccctaaacttctctagcaatcgaacaaattgatac |
76976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 17 - 105
Target Start/End: Original strand, 68712 - 68800
Alignment:
| Q |
17 |
tttttgcttgtcgatgaaatctttctctgaaccaaatgcaattcttaactttcccatatagctcatgatcgttactgtgagactctgca |
105 |
Q |
| |
|
|||||||||||| || || |||||||| | |||||||||||||||||||||||||| |||||||| || |||| || |||||||||| |
|
|
| T |
68712 |
tttttgcttgtcaataaagtctttctccaatccaaatgcaattcttaactttcccatgtagctcataatggttatggttagactctgca |
68800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University