View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4397_high_16 (Length: 239)
Name: NF4397_high_16
Description: NF4397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4397_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 173 - 235
Target Start/End: Complemental strand, 14500967 - 14500901
Alignment:
| Q |
173 |
cacctttttgggattcaaaaaatcatattttctagtttttaa----ctcaaaagtgaaatatttgaa |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14500967 |
cacctttttgggattcaaaaaatcatattttctagtttttaactatctcaaaagtgaaatatttgaa |
14500901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 66 - 103
Target Start/End: Complemental strand, 14505059 - 14505022
Alignment:
| Q |
66 |
ccacatcaaatccatcaataatatgaatatataattca |
103 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
14505059 |
ccacatcaaatccatcaataatataaatatatagttca |
14505022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University