View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4397_low_12 (Length: 275)

Name: NF4397_low_12
Description: NF4397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4397_low_12
NF4397_low_12
[»] scaffold0024 (3 HSPs)
scaffold0024 (1-112)||(76761-76872)
scaffold0024 (166-216)||(76926-76976)
scaffold0024 (17-105)||(68712-68800)


Alignment Details
Target: scaffold0024 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 76761 - 76872
Alignment:
1 ccatacagcacttgattttttgcttgtcgatgaaatctttctctgaaccaaatgcaattcttaactttcccatatagctcatgatcgttactgtgagact 100  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
76761 ccatacagcacttgattttttgcttgtcaatgaaatctttctctgaaccaaatgcaattcttaactttcccatatagctcatgatcgttactgtgagact 76860  T
101 ctgcaattccac 112  Q
    ||||||||||||    
76861 ctgcaattccac 76872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 76926 - 76976
Alignment:
166 taatcgtcaattttgtccctaaacttctctagcaatcgaacaaattgatac 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
76926 taatcgtcaattttgtccctaaacttctctagcaatcgaacaaattgatac 76976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 17 - 105
Target Start/End: Original strand, 68712 - 68800
Alignment:
17 tttttgcttgtcgatgaaatctttctctgaaccaaatgcaattcttaactttcccatatagctcatgatcgttactgtgagactctgca 105  Q
    |||||||||||| || || ||||||||  | |||||||||||||||||||||||||| |||||||| || ||||  || ||||||||||    
68712 tttttgcttgtcaataaagtctttctccaatccaaatgcaattcttaactttcccatgtagctcataatggttatggttagactctgca 68800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University