View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4397_low_2 (Length: 582)
Name: NF4397_low_2
Description: NF4397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4397_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 529; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 529; E-Value: 0
Query Start/End: Original strand, 19 - 567
Target Start/End: Complemental strand, 38243558 - 38243010
Alignment:
| Q |
19 |
tttggccgccaagatgcccggaaatctaaaagtgagtcaagctttggttatcagttgcagttgttttgtgttgtagtatgatgattgtttgattttatga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38243558 |
tttggccgccaagatgcccggaaatctaaaagtgagtcaagctttggttatcagttgcagttgttttgtgttgtagtatgatgattgtttgattttatga |
38243459 |
T |
 |
| Q |
119 |
atgcatgatgcctcttatttattatgttatttttatgcattcattggtgacacactgttcaatttttattatgtgttgggtttgattgaatgtgtcaact |
218 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38243458 |
ttgcatgatgcctctgatttattatgttatttttatgcattcattggtgaaacactgttcaatttttattatgtgttgggtttgattgaatgtgtcaact |
38243359 |
T |
 |
| Q |
219 |
tttgaattgcaggttgtgtattttgtaaattctggttcggaagcaaatgaattggcaatgctgatggcaagattgtataccggtaatcttggtatgattt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38243358 |
tttgaattgcaggttgtgtattttgtaaattctggttcggaagcaaatgaattggcaatgctgatggcaagattgtataccggtaatcttggtatgattt |
38243259 |
T |
 |
| Q |
319 |
ctttaaggaatgcataccatgggggtagttctagtacaatgggtctcaccgctcttaacacatggaaatacccacttcctgaggtttgtttcttcaggct |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38243258 |
ctttaaggaatgcataccatgggggtagttctagtacaatgggtctcaccgctcttaacacatggaaatacccacttcctgaggtttgtttcttcaggct |
38243159 |
T |
 |
| Q |
419 |
tcatcagaatatttcaattcatcctgcatatggcccttttgaatccaataggcgttataagttatagtatactgtacacatgtattcggccagctatgtt |
518 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38243158 |
tcatcagaatatttcaattcatactgcatatggcccttttgaatccaataggcgttataagttatagtatactgtacacatgtattcggccaactatgtt |
38243059 |
T |
 |
| Q |
519 |
atttttcctaaatgtggtgtttgcggacttgcagctattcgtaattcat |
567 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38243058 |
atttttcctaaatgtggtgtttgcggacttgcagctattcgtaattcat |
38243010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University