View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4397_low_20 (Length: 214)
Name: NF4397_low_20
Description: NF4397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4397_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 17 - 183
Target Start/End: Complemental strand, 28590681 - 28590513
Alignment:
| Q |
17 |
aaatctctcactctcttgtgttactttaattttaannnnnnnnnn--attgatttgtttattattctgaactttggtatgtgaaaatgacaagagtaaga |
114 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28590681 |
aaatctctcactctcttgtgttactttgattttaatttattttttttattgatatgtttattattctgaactttggtatgtgaaaatgacaagagtaaga |
28590582 |
T |
|
| Q |
115 |
aaaggaaataatagtgacactgcaactctcaaaaagagtttgcatgcatatatgatatgtttgtaatga |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28590581 |
aaaggaaataatagtgacactgcaactctcaaaaagagtgtgcatgcatatatgatatgtttgtaatga |
28590513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University