View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4398_high_10 (Length: 264)
Name: NF4398_high_10
Description: NF4398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4398_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 42 - 244
Target Start/End: Original strand, 3046998 - 3047200
Alignment:
| Q |
42 |
acttggtttggattagctttttggtctgctgttatttgcatctgattttacaaattgatttaatgttttgtttgtatggtgtaatagaggtcattgctgg |
141 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3046998 |
acttggtttggattagctttttggtgtgctgttatttgcatctgattttacaaattgatttaatgttttgtttgtatggtgtaatagaggtcattgctgg |
3047097 |
T |
 |
| Q |
142 |
ctgtttttctggtatggacatgcaaatacttgttctacttagtttggcttagctttttggtctacttatatattatttgctaatgctacatagtggcatg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3047098 |
ctgtttttctggtatggacatgcaaatacttgttctacttagtttggcttagctttttggtctacttatatattatttgctaatgctacatagtggcatg |
3047197 |
T |
 |
| Q |
242 |
atc |
244 |
Q |
| |
|
||| |
|
|
| T |
3047198 |
atc |
3047200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 113 - 202
Target Start/End: Original strand, 3046932 - 3047022
Alignment:
| Q |
113 |
ttgtatggtgtaatagaggtcattgctggctgtttttctggtatggacatgcaaatactt-gttctacttagtttggcttagctttttggt |
202 |
Q |
| |
|
|||||| || |||||||||| ||| |||||||||||||||| | |||| ||| | |||| ||| ||||| |||||| ||||||||||||| |
|
|
| T |
3046932 |
ttgtattgtataatagaggttatttgtggctgtttttctggttttgacaagcataaacttggttttacttggtttggattagctttttggt |
3047022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University