View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4401_low_3 (Length: 396)
Name: NF4401_low_3
Description: NF4401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4401_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 322; Significance: 0; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 14 - 378
Target Start/End: Original strand, 34090519 - 34090877
Alignment:
| Q |
14 |
aaaaacagttcatatctaatcttctgattgctatcaccaaaggctaaaactgaagtaccagctttgcatgcttgatcaggtgcacacccgttttgagtat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34090519 |
aaaaacagttcatatctaatcttctgattgctatcaccaaaggctaaaactgaagtaccagctttgcatgtttgatcaggtgcacacccgttttgagtat |
34090618 |
T |
|
| Q |
114 |
ctgtgtttgattgccaaacaccccctggtgggtttattgcaatttggaaagttaaggatgcagtaactgtggctaccaccattaaggaacctctcatttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34090619 |
ctgtgtttgattgccaaacaccccctggtgggtttattgcaatttggaaagttaaggatgcaataactgtggctaccaccattaaggaacctctcatttg |
34090718 |
T |
|
| Q |
214 |
ttccatccaatttccttgattgttttcatattcataccttgtgaattggttattagcccatgatcgtcctagtaatacttgttctccattctgaaccaca |
313 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34090719 |
ttccatccaatttccttgattgtt------ttcataccttgtgaattggttattagcccatgatcgtcctggtaatacttgttctccattctgaaccaca |
34090812 |
T |
|
| Q |
314 |
acaccctccattgtttttctagttattttttgctttactagttgttttcttctaagctgtgatga |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
34090813 |
acaccctccattgtttttctagttattttttgcttaactagttgttttcttctaagttgtgatga |
34090877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 119 - 330
Target Start/End: Original strand, 34093569 - 34093774
Alignment:
| Q |
119 |
tttgattgccaaacaccccctggtgggtttattgcaatttggaaagttaaggatgcagtaactgtggctaccaccattaaggaacctctcatttgttcca |
218 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34093569 |
tttgattgccaaacacctcctggtgggtttattgcaatttggaaagttaaggatgccataactgtggctaccaccattagggaacctctcatttgttcca |
34093668 |
T |
|
| Q |
219 |
tccaatttccttgattgttttcatattcataccttgtgaattggttattagcccatgatcgtcctagtaatacttgttctccattctgaaccacaacacc |
318 |
Q |
| |
|
||| ||||||||||| ||||| ||| ||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
34093669 |
tcctatttccttgatctttttcgtat------cttgtgaattggttattagcccatgatgatcctggtaatacttgtgttccattctgaaccacaacacc |
34093762 |
T |
|
| Q |
319 |
ctccattgtttt |
330 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34093763 |
ctccattgtttt |
34093774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 99
Target Start/End: Original strand, 34096799 - 34096878
Alignment:
| Q |
20 |
agttcatatctaatcttctgattgctatcaccaaaggctaaaactgaagtaccagctttgcatgcttgatcaggtgcaca |
99 |
Q |
| |
|
||||||||||||| || || |||||||||||||| ||||||||| |||||| |||||||||| ||||||| ||||||| |
|
|
| T |
34096799 |
agttcatatctaaatttttggttgctatcaccaaatgctaaaactaaagtactagctttgcatatttgatcatgtgcaca |
34096878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 16 - 75
Target Start/End: Original strand, 34093494 - 34093553
Alignment:
| Q |
16 |
aaacagttcatatctaatcttctgattgctatcaccaaaggctaaaactgaagtaccagc |
75 |
Q |
| |
|
||||| ||||||||||| ||| ||| ||| ||||||| | |||||||||||||||||||| |
|
|
| T |
34093494 |
aaacatttcatatctaagcttttgagtgccatcaccagatgctaaaactgaagtaccagc |
34093553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 91
Target Start/End: Original strand, 34092660 - 34092710
Alignment:
| Q |
41 |
ttgctatcaccaaaggctaaaactgaagtaccagctttgcatgcttgatca |
91 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||||||||| ||||||| |
|
|
| T |
34092660 |
ttgctatcaccaaatgctagaactaaagtaccagctttgcatatttgatca |
34092710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University