View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4402-Insertion-6 (Length: 394)
Name: NF4402-Insertion-6
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4402-Insertion-6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 370; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 370; E-Value: 0
Query Start/End: Original strand, 8 - 392
Target Start/End: Original strand, 36125196 - 36125583
Alignment:
| Q |
8 |
agctctagtctagatttgatcgacagtgataatattattatattaacta---tttatgaattaattatggttttgttgatgtcagtggtggtggtctttt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36125196 |
agctctagtctagatttgatcgacagtgataatattattatattaactagtatttatgaattaattatggttttgttgatgtcagtggtggtggtctttt |
36125295 |
T |
 |
| Q |
105 |
ggcatacggtgaggctgttgctacatctgaatcggcggtgcctgagaagaaaaaggtgctggtgctgggaactggttgggcaggaacaagtttcttgagg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36125296 |
ggcatacggtgaggctgttgctacatctgaatcggcggtgcctgagaagaaaaaggtgctggtgctgggaactggttgggcaggaacaagtttcttgagg |
36125395 |
T |
 |
| Q |
205 |
aatctcaacgatcccagatatgaggttcacgtcgtttctcctcgcaattattttactttcactcctctgctgcctagtgttacctgtggcaccgtcgagg |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36125396 |
aatctcaacgatcccagatatgaggttcacgtcgtttctcctcgcaattattttactttcactcctctgctgcctagtgttacctgtggcaccgtcgagg |
36125495 |
T |
 |
| Q |
305 |
ctcgcagcattgtggaaccagtccgcaatatcttcaggaaggtcaggaatctcaggattaaaacatttttcttagctcggtagcactg |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36125496 |
ctcgcagcattgtggaaccagtccgcaatatcttcaggaaggtcaggaatctcaggattaaaacatttttcttagctctgtagcactg |
36125583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University