View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4402-Insertion-7 (Length: 76)
Name: NF4402-Insertion-7
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4402-Insertion-7 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 2e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 7 - 76
Target Start/End: Complemental strand, 3216234 - 3216165
Alignment:
| Q |
7 |
aaacacttcattcaatcaacagtgttctaattatgaagggaaggtatgtagcatatttggtagcactgtc |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
3216234 |
aaacacttcattcaatcaacagtgttctaattatgaagggaaggtatgtagcatatttggttgcgctgtc |
3216165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 3e-23
Query Start/End: Original strand, 11 - 73
Target Start/End: Original strand, 15989240 - 15989302
Alignment:
| Q |
11 |
acttcattcaatcaacagtgttctaattatgaagggaaggtatgtagcatatttggtagcact |
73 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15989240 |
acttcattcaatcatcagtgttctaattatgaagggaaggtatgtagcatatttggttgcact |
15989302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.0000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.0000000000004
Query Start/End: Original strand, 30 - 67
Target Start/End: Complemental strand, 23725400 - 23725363
Alignment:
| Q |
30 |
gttctaattatgaagggaaggtatgtagcatatttggt |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23725400 |
gttctaattatgaagggaaggtatgtagcatatttggt |
23725363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University