View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4402_high_29 (Length: 369)
Name: NF4402_high_29
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4402_high_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 16 - 353
Target Start/End: Complemental strand, 43116220 - 43115883
Alignment:
| Q |
16 |
atcatccacctccgatcatcaatcttcaacaaacacagacacatcaccaccgatggccgcacccaatatgatgtattacccaccgggtaccggttaccct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43116220 |
atcatccacctccgatcatcaatcttcaacaaacacagacacatcaccaccggtggccgcacccaatatgatgtattacccaccgggtaccggttaccct |
43116121 |
T |
 |
| Q |
116 |
tgccatggcccacagccaccaccctatcatccttacccaccacctccacacggataccccccataccagcagggatacaataactttcctggtcatgcac |
215 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43116120 |
tgccatggtccacagccaccaccctatcatccttacccaccacctccacacggataccccccataccagcagggatacaataactttcctggtcatgcac |
43116021 |
T |
 |
| Q |
216 |
catactatgacgtccctcgaacctatcatcacaccggtgatggtggtagcagcttctttcgtggatttataatgtgttcatgttttatatttacaggctt |
315 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43116020 |
catactatgacgtccctcgaacatatcatcacaccggtgatggtggtagcagcttctttcgtggatttataatgtgttcatgttttatatttacaggctt |
43115921 |
T |
 |
| Q |
316 |
ctttgttctaactctcattgcggcattatcgttacatc |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43115920 |
ctttgttctaactctcattgcggcattatcgttacatc |
43115883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University