View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4402_high_35 (Length: 346)
Name: NF4402_high_35
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4402_high_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 45 - 233
Target Start/End: Complemental strand, 27511610 - 27511420
Alignment:
| Q |
45 |
atgtatttgtatgtatgtggcaaa-gtgatgtgtccaagtatgtgtggggg-atctgatgtattttgtgtcgagacaaaagccattttgactggtattga |
142 |
Q |
| |
|
|||||||||| ||| |||| |||| |||||||||||||| ||||||||||| ||||||||| ||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
27511610 |
atgtatttgtctgtgtgtgtcaaaagtgatgtgtccaagcatgtgtggggggatctgatgtgttttgtgccgagacaaaagccattttgactagtattga |
27511511 |
T |
|
| Q |
143 |
attttgttttaaggtaggttttaagaaacttgtatgtttttcagacttccttcgtgttattcaattgttgactcctgttccttaaagatat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27511510 |
attttgttttaaggtaggttttaagaaacttgtatgtttttcagacttccttcgtgttattcaattgttgactcctgttccttacagatat |
27511420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University