View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4402_high_71 (Length: 215)
Name: NF4402_high_71
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4402_high_71 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 1920777 - 1920565
Alignment:
| Q |
1 |
taagttgcttaattgcaatatgttaggatctgagatccacaaactctcttagaggtgtgtggatgacttcgagtcgtcggtcttcaatcagtagatttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1920777 |
taagttgcttaattgcaatatgttaggatctgagatccacaatctctcttagaggtgtg--gatgacttcgagtcgtcggtcttcaatcagtagattcgt |
1920680 |
T |
 |
| Q |
101 |
tcttctccgaagagggaggataaagatatagtggctatgtttaattttaatggagatgaagaagaggaatttccagatgatggagacaaaagagggcaag |
200 |
Q |
| |
|
||||||||||||||||||||| | ||| ||||||| | ||||||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
1920679 |
tcttctccgaagagggaggatgaggatgtagtggccacatttaattttaatggagaggaagaagaggaatttccagatggtggagacgaaagagggcaag |
1920580 |
T |
 |
| Q |
201 |
tgaccccgtgtttga |
215 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
1920579 |
tggccccgtgtttga |
1920565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University