View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4402_low_53 (Length: 289)
Name: NF4402_low_53
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4402_low_53 |
 | |
|
| [»] scaffold0014 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 59; Significance: 5e-25; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 210 - 272
Target Start/End: Complemental strand, 32007208 - 32007146
Alignment:
| Q |
210 |
ccaaaaatgaatctccccgacgatctcttctcttccgaactttccaccgattcacactcttct |
272 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32007208 |
ccaaaaatgaatctccccaacgatctcttctcttccgaactttccaccgattcacactcttct |
32007146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 197 - 272
Target Start/End: Complemental strand, 32002298 - 32002224
Alignment:
| Q |
197 |
agaaagcatttatccaaaaatgaatctccccgacgatctcttctcttccgaactttccaccgattcacactcttct |
272 |
Q |
| |
|
||||||||| ||||||||||||||||| || |||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
32002298 |
agaaagcatctatccaaaaatgaatcttcc-gacgatctcttctcttccaaactttccaccgagtcacactcttct |
32002224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 271
Target Start/End: Complemental strand, 66756 - 66685
Alignment:
| Q |
200 |
aagcatttatccaaaaatgaatctccccgacgatctcttctcttccgaactttccaccgattcacactcttc |
271 |
Q |
| |
|
|||||||||||||||| || ||||| | || |||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
66756 |
aagcatttatccaaaactggatctcgctaacaatctcttctcttgccaactttccaccgattcacactcttc |
66685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 250
Target Start/End: Original strand, 9335564 - 9335601
Alignment:
| Q |
213 |
aaaatgaatctccccgacgatctcttctcttccgaact |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
9335564 |
aaaatgaatctccccgacgatctcttctcatccaaact |
9335601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University