View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4402_low_55 (Length: 284)
Name: NF4402_low_55
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4402_low_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 12 - 274
Target Start/End: Complemental strand, 54015199 - 54014937
Alignment:
| Q |
12 |
attattagtatagaagatgggggctcctttatcatcatggccatgggaaagctttggaatattcaaggtacataaataacatctatgtatgtttctcttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54015199 |
attattagtatagaagatgggggctcctttatcatcatggccatgggaaaactttggaatattcaaggtacataaataacatctatgtatgtttctcttt |
54015100 |
T |
 |
| Q |
112 |
tattatgataaaacaaattcttttgtggcaataacatgtatgtatgtttctttgttattttaaattgtagtatgtattatatggaccaattgtggggaaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54015099 |
tattatgataaaacaaattcttttgtggcaataacatgtatgtatgtttctttgttattttaaattgtagtatgtattatatggaccaattgtggggaaa |
54015000 |
T |
 |
| Q |
212 |
gtattgtatgaaattttgaatgaagaaccctcatactccaacctcagctggtggtgcattcat |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54014999 |
gtattgtatgaaattttgaatgaagaaccctcatactccaacctcagctggtggtgcattcat |
54014937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University