View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4402_low_56 (Length: 283)
Name: NF4402_low_56
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4402_low_56 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 283
Target Start/End: Complemental strand, 9467306 - 9467049
Alignment:
| Q |
19 |
gtacagaacaaattaat-gtggtttaaataccaacccatgttgcaatttacccattcttaactcaacacacttggatgggacgataaggcctaaggtttt |
117 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9467306 |
gtacagaacaaactaattgtggtttaaataccaacccatgttgcaatttacccattcttaactcaacacacttggatgggacgataaggcctaaggtttt |
9467207 |
T |
 |
| Q |
118 |
ccggtttaactaaatgttttggatttaaattcaatcttaaaaataaatacaatagtgtttacgttttttgagagagttttgctgcatattatagttttat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9467206 |
ccggtttaactaaatgttttggatttaaattcaatcttaaaaataaataca------------ttttttgagagagttttgctgcatattatagttttat |
9467119 |
T |
 |
| Q |
218 |
gtggttcaatgaatat----agttatgcgtaaagatatctgatacacatcaatatatattttttcccatt |
283 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9467118 |
gtggttcaatgaatatatacagttatgcataaagatatctgatacacatcaatatatattttttcccatt |
9467049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University