View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4402_low_66 (Length: 242)
Name: NF4402_low_66
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4402_low_66 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 108 - 172
Target Start/End: Original strand, 26305894 - 26305958
Alignment:
| Q |
108 |
ttgtgtaccgcagttttgaactatgtgtgacagaatacacatttaagaacaaacattacgatcag |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26305894 |
ttgtgtaccgcagttttgaactatgtgtgacagaatacacatttaagaacaaacattacgatcag |
26305958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 12 - 82
Target Start/End: Original strand, 26305828 - 26305898
Alignment:
| Q |
12 |
acagacagaagaatcaattgtgacagtatagttctaaaatgctgacaaatgcagctacaaatatgattgtg |
82 |
Q |
| |
|
||||||| ||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26305828 |
acagacaaaagaagcaattgtgacagcatagttctaaaatgctgacaaatgcagctacaaatatgattgtg |
26305898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 168 - 221
Target Start/End: Original strand, 26305987 - 26306040
Alignment:
| Q |
168 |
atcagagccagtacagaacaaattgaatgaaaatatggaacataaacgagtttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26305987 |
atcagagccagtacagaacaaattgaatgaaaatatggaacataaacgagtttt |
26306040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University