View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4402_low_67 (Length: 241)
Name: NF4402_low_67
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4402_low_67 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 241
Target Start/End: Original strand, 46551382 - 46551606
Alignment:
| Q |
17 |
agtgatgctctccctggtttgtacatggtagatctcttaagttggattttagggaaaggcgtgattagttgttatttgctgtaggatagttatgtatttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46551382 |
agtgatgctctccctggtttgtacatggtagatctcttaagttggattttagggaaaggcgtgattagttgttatttgctgtaggatagttatgtatttg |
46551481 |
T |
 |
| Q |
117 |
gagtggcagttatctgcgtggttatagacatatatacatatagaaattatggggggatgtcnnnnnnnnaccgtttgagcagtgtttgaaagagggaact |
216 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46551482 |
gagtggcagttatctgtgtggttatagacatatatacatatagaaattatggggggatgtcttttttttaccgtttgagcagtgtttgaaagagggaact |
46551581 |
T |
 |
| Q |
217 |
ccttgtataattctggtttatactt |
241 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46551582 |
ccttgtataattctggtttatactt |
46551606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 31 - 241
Target Start/End: Original strand, 1027929 - 1028145
Alignment:
| Q |
31 |
tggtttgtacatggtagatctcttaagttggattttagggaaaggcgtgattagttgttatttgctgtaggatagttatgtatttggagtggcagttatc |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1027929 |
tggtttgtacatggtagatctcttaagttggattttagggaaaggcgtgattagttgttatttgctgtaggatagttatgtatttggagtggcagttatc |
1028028 |
T |
 |
| Q |
131 |
tgcgtggttatagacatatataca-------tatagaaattatggggggatgtcnnnnnnnnaccgtttgagcagtgtttgaaagagggaactccttgta |
223 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||| ||||| || ||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
1028029 |
tgcgtggttatagatatatatacatatagtctatagaaattatgggggaatgtc-tttttttactgtttgtgcagtgtttgaaacagggaactccttgta |
1028127 |
T |
 |
| Q |
224 |
taattctggtttatactt |
241 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
1028128 |
taattctgttttatactt |
1028145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University