View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4402_low_69 (Length: 238)
Name: NF4402_low_69
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4402_low_69 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 4 - 222
Target Start/End: Complemental strand, 19791518 - 19791300
Alignment:
| Q |
4 |
catttcgttatgcaaggggatttacaaaattgttgctaaggtgattgctaaccgcattaaggatctcatgcgtaaaatcattttgccaaatcaaaataga |
103 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19791518 |
catttcattatgcaaggtgatttacaaaattgttgctaaggtgattgctaaccgcattaaggatctcatgcgtaaaatcattttgccaaatcaaaataga |
19791419 |
T |
 |
| Q |
104 |
tttatttcaggtaagagtactattgattatactattattctccaggagattgtccattccatagttaggagtggaagttgtaattaagttgtttgtcatc |
203 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19791418 |
tttatttcaggtaggagtactattgattatactatcattctccatgagattgtccattccatagttaggagtggaagttgtaattaagttgtttgtcatc |
19791319 |
T |
 |
| Q |
204 |
aacgttgtagctagggaat |
222 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
19791318 |
aacgttgtagctagggaat |
19791300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University