View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4402_low_71 (Length: 237)
Name: NF4402_low_71
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4402_low_71 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 86 - 237
Target Start/End: Complemental strand, 9315711 - 9315560
Alignment:
| Q |
86 |
ggtcacttatttatattcattatcatttattttcagttaattgaaggatgtgcggtggacctgacaaatcaaaatcaattgcaacgtcatcatcttcctc |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9315711 |
ggtcacttatttatattcattatcatttattttcagttaattgaaggatgtgcggtggacctgacaaatcaaaatctattgcaacgtcatcatcttcctc |
9315612 |
T |
|
| Q |
186 |
ttcatctgcggctgaaggttcaaatactgtcgaagacatgaaaaatctaact |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9315611 |
ttcatctgcggctgaaggttcaaatactgtcgaagacatgaaaaatctaact |
9315560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 116 - 161
Target Start/End: Complemental strand, 11689221 - 11689176
Alignment:
| Q |
116 |
tttcagttaattgaaggatgtgcggtggacctgacaaatcaaaatc |
161 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
11689221 |
tttcagataatagaaggatgtgcggtggacctgaaaaatcaaaatc |
11689176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University