View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4402_low_73 (Length: 236)
Name: NF4402_low_73
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4402_low_73 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 40706265 - 40706485
Alignment:
| Q |
1 |
ccctaaactagcactctcacatatccctattctagcaagtacaaattatagcaaaaatagcacatatatgctagtttagagagcagagaactgcaaatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40706265 |
ccctaaactagcactctcacatatccctattctagcaagtacaaattatagcaaaaatagcacatatatgctagtttagagaacagagaactgcaaatta |
40706364 |
T |
|
| Q |
101 |
caattttatccgcgccagctgttagacctctttgcttcgaaggctgctccatcattaagcatgtcttgtgcatcagtttccatccccagctttgagagag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40706365 |
caattttatccgcgccagctgttagacctctttgcttcgaaggctgctccatcattaagcatgtcttgtgcatcagtttccatccccagctttgagagag |
40706464 |
T |
|
| Q |
201 |
caagtgcttgcaggtagaatg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40706465 |
caagtgcttgcaggtagaatg |
40706485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 66 - 103
Target Start/End: Complemental strand, 6207698 - 6207661
Alignment:
| Q |
66 |
atatgctagtttagagagcagagaactgcaaattacaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6207698 |
atatgctagtttagagagcagagaactgcagattacaa |
6207661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University