View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4402_low_76 (Length: 234)
Name: NF4402_low_76
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4402_low_76 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 29252729 - 29252612
Alignment:
| Q |
1 |
tacctgataattcaggagagttgcatttcaacattgtgaatgaaaaaccaaaatacattttgaaactaggag--catgggagtttcgtttccgaccttgc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29252729 |
tacctgataattcaggagagttgcatttcaacattgtgaatgaaaaaccaaaatacattttgaaactaggagcacatgggagtttcgtttccgaccttgc |
29252630 |
T |
 |
| Q |
99 |
tatgagacaaggtgattt |
116 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
29252629 |
tatgagacaaggtgattt |
29252612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 10 - 166
Target Start/End: Complemental strand, 7250285 - 7250127
Alignment:
| Q |
10 |
attcaggagagttgcatttcaacattgtgaatgaaaaaccaaaatacattttgaaactaggag--catgggagtttcgtttccgaccttgctatgagaca |
107 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||||| | | |||| ||||| |||||||| | | ||| |
|
|
| T |
7250285 |
attcaggagagttagatttccacattgtgaatgaaaaaccaaaatatcttttgaaactaggagaacccgttggttttgtttcgaaccttgctgttaaaca |
7250186 |
T |
 |
| Q |
108 |
aggtgattttacatggatgcgtgaacaaccgctacatgcaacattcgacttgtatgatc |
166 |
Q |
| |
|
||| || || | ||||| |||| | ||||||||||||||||| |||||||| ||||||| |
|
|
| T |
7250185 |
aggcgagttgagatggacgcgttatcaaccgctacatgcaacgttcgacttatatgatc |
7250127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 3 - 72
Target Start/End: Complemental strand, 9892909 - 9892840
Alignment:
| Q |
3 |
cctgataattcaggagagttgcatttcaacattgtgaatgaaaaaccaaaatacattttgaaactaggag |
72 |
Q |
| |
|
||||| ||||||| |||||| ||||||| |||||||||||||||||| || || ||||||||| ||||| |
|
|
| T |
9892909 |
cctgaaaattcagaagagttacatttcatcattgtgaatgaaaaacctaattatgttttgaaacaaggag |
9892840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 105 - 166
Target Start/End: Complemental strand, 9892805 - 9892744
Alignment:
| Q |
105 |
acaaggtgattttacatggatgcgtgaacaaccgctacatgcaacattcgacttgtatgatc |
166 |
Q |
| |
|
||||||| | || |||||||| ||| ||||||| |||||||||||||| |||||||||||| |
|
|
| T |
9892805 |
acaaggtcaattgacatggatacgtaaacaaccattacatgcaacattcaacttgtatgatc |
9892744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 118 - 166
Target Start/End: Original strand, 9212426 - 9212474
Alignment:
| Q |
118 |
acatggatgcgtgaacaaccgctacatgcaacattcgacttgtatgatc |
166 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
9212426 |
acatgggtgcgtcaacaaccactacatgcaacattcaacttgtatgatc |
9212474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University