View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4402_low_83 (Length: 220)
Name: NF4402_low_83
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4402_low_83 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 11523509 - 11523307
Alignment:
| Q |
18 |
tccctcattctcaaatctctcaaaaaccctaccctcgctttcaaattcttccacttttgcccctccctcaaaaacgaccctttcatctataaccgtcttt |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11523509 |
tccctcattctcaaatccctcaaaaaccctaccctcgctttcaaattcttccacttttgcccctccctcaaaaacgaccctttcatctataaccgtcttt |
11523410 |
T |
 |
| Q |
118 |
tccttaccctctcacgctcctcttccccgcttagattcgaacagacggagtctctgcttgatgatatggagaaacgcggcgtgaagggatcgatttcgac |
217 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11523409 |
tccttaccctctcacgctcctcttcccagcttagattcgaacagacggagtctttgcttgatgatatggagaaacgcggcgtgaagggatcgatttcgac |
11523310 |
T |
 |
| Q |
218 |
tgt |
220 |
Q |
| |
|
||| |
|
|
| T |
11523309 |
tgt |
11523307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University