View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4402_low_83 (Length: 220)

Name: NF4402_low_83
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4402_low_83
NF4402_low_83
[»] chr2 (1 HSPs)
chr2 (18-220)||(11523307-11523509)


Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 11523509 - 11523307
Alignment:
18 tccctcattctcaaatctctcaaaaaccctaccctcgctttcaaattcttccacttttgcccctccctcaaaaacgaccctttcatctataaccgtcttt 117  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11523509 tccctcattctcaaatccctcaaaaaccctaccctcgctttcaaattcttccacttttgcccctccctcaaaaacgaccctttcatctataaccgtcttt 11523410  T
118 tccttaccctctcacgctcctcttccccgcttagattcgaacagacggagtctctgcttgatgatatggagaaacgcggcgtgaagggatcgatttcgac 217  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
11523409 tccttaccctctcacgctcctcttcccagcttagattcgaacagacggagtctttgcttgatgatatggagaaacgcggcgtgaagggatcgatttcgac 11523310  T
218 tgt 220  Q
    |||    
11523309 tgt 11523307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University