View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4402_low_85 (Length: 215)

Name: NF4402_low_85
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4402_low_85
NF4402_low_85
[»] chr6 (1 HSPs)
chr6 (1-215)||(1920565-1920777)


Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 1920777 - 1920565
Alignment:
1 taagttgcttaattgcaatatgttaggatctgagatccacaaactctcttagaggtgtgtggatgacttcgagtcgtcggtcttcaatcagtagatttgt 100  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||  |||||||||||||||||||||||||||||||||||| ||    
1920777 taagttgcttaattgcaatatgttaggatctgagatccacaatctctcttagaggtgtg--gatgacttcgagtcgtcggtcttcaatcagtagattcgt 1920680  T
101 tcttctccgaagagggaggataaagatatagtggctatgtttaattttaatggagatgaagaagaggaatttccagatgatggagacaaaagagggcaag 200  Q
    ||||||||||||||||||||| | ||| ||||||| |  ||||||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||    
1920679 tcttctccgaagagggaggatgaggatgtagtggccacatttaattttaatggagaggaagaagaggaatttccagatggtggagacgaaagagggcaag 1920580  T
201 tgaccccgtgtttga 215  Q
    || ||||||||||||    
1920579 tggccccgtgtttga 1920565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University