View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4402_low_89 (Length: 202)
Name: NF4402_low_89
Description: NF4402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4402_low_89 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 21 - 94
Target Start/End: Complemental strand, 48216240 - 48216167
Alignment:
| Q |
21 |
tacccaattttgattggaatcgaaggcatgaagaaagcacaagcttatttttaaaatccaaaagcccatcacta |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
48216240 |
tacccaattttgattggaatcgaaggcatgaagaaagcacaaggttatttttaaaatccaaaagccaatcacta |
48216167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 150 - 188
Target Start/End: Complemental strand, 48216107 - 48216069
Alignment:
| Q |
150 |
gattcaacatccatgaaacccatatcaatatgagaatta |
188 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48216107 |
gattcaacatccatgaaactcatatcaatatgagaatta |
48216069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 21 - 92
Target Start/End: Original strand, 38614491 - 38614563
Alignment:
| Q |
21 |
tacccaattttgattggaatcgaa-ggcatgaagaaagcacaagcttatttttaaaatccaaaagcccatcac |
92 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
38614491 |
tacccagttttgattggaatcgaaaggcatgaagaaagcacaagcttatttttcaaatccaaaagccaatcac |
38614563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 43389309 - 43389251
Alignment:
| Q |
28 |
ttttgattggaatcgaa-ggcatgaagaaagcacaagcttatttttaaaatccaaaagc |
85 |
Q |
| |
|
||||||| ||||| ||| |||| ||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
43389309 |
ttttgatcggaattgaatggcacgaagaaagcacaagcttatttttcaaatccacaagc |
43389251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University