View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4403_low_12 (Length: 309)
Name: NF4403_low_12
Description: NF4403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4403_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 71 - 259
Target Start/End: Complemental strand, 53479775 - 53479587
Alignment:
| Q |
71 |
ctcttttcacatagcagcaacgtgtcatcagcaaactctaataggaaaattctaaacattactaatttgaaaatccttatacacctaaaatttgaggatg |
170 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53479775 |
ctcttttctcatagcagcaacgtgccatcagcaaactctaaaaggaaaattctaaacattactaatttgaaaatccttatacacctaaaatttgaggatg |
53479676 |
T |
 |
| Q |
171 |
cacgaatcaaagaattaaatctttcaatggctaataaaaacaagatatatagaagacaaatgatctccttgccttaactcccaagcatt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
53479675 |
cacgaatcaaagaattaaatctttcaatggctaataaaaacaagatatatagaagacaaatgatctccttgccttaactctcaagcatt |
53479587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 53479957 - 53479895
Alignment:
| Q |
1 |
cggttaaaaattgacagcctacttggattatctccaattgacaaacacaaatacttaaatggg |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53479957 |
cggttaaaaattgacagcctacttggattatctccaattgacaaacacaaatacttaaatggg |
53479895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University