View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4404-Insertion-7 (Length: 266)
Name: NF4404-Insertion-7
Description: NF4404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4404-Insertion-7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 7 - 266
Target Start/End: Complemental strand, 31479426 - 31479164
Alignment:
| Q |
7 |
aaactgggcagtggcagtcccagtggcacatgcatgtctctgccttaagaattcaataataaatttgtccattggtatggccattggttactgttgattc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31479426 |
aaactgggcagtggcagtcccagtggcacatgcatgtctctgccttaagaattcaataataaatttgtccattggtatggctattggttactgttgattc |
31479327 |
T |
|
| Q |
107 |
ttcacgccttgtctccttctttggggtcctttgctgtatgataaattaactaattgccaatgtgaactgtgaactacttatttggcatcatttgcggact |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
31479326 |
ttcacgccttgtctccttctttggggtcctttgctgtatgataaatcaactaattgccaa-------tgcgaactacttatttggcatcatttgcggact |
31479234 |
T |
|
| Q |
207 |
atgctttattgtttttaccatgtaca----------ttatgtaaattttagatactctaaattttagttg |
266 |
Q |
| |
|
|||||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31479233 |
atgctttattttttttaccatggacataatcaagatttatgtaaattttagatactctaaattttagttg |
31479164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University