View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4404-Insertion-9 (Length: 194)
Name: NF4404-Insertion-9
Description: NF4404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4404-Insertion-9 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 6e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 6e-82
Query Start/End: Original strand, 8 - 194
Target Start/End: Complemental strand, 18845221 - 18845035
Alignment:
| Q |
8 |
gatgaatcacccaaccatagggtaataataattcatggaaacatgtatttataagagtcacggggatccaatatccatcacatgatttagaaatgcttac |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18845221 |
gatgaatcacccaaccatagggtaataat---tcgtggaaacatgtatttataagagtcacggggatccaatatccatcacatgatttagaaatgcttac |
18845125 |
T |
|
| Q |
108 |
aaatc---agtggtcaatgcaatggaaagaataagtcacgaatcaaatgtgcttttcttgtcttatacactttgtattggtagcttatag |
194 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18845124 |
aaatcagtagtagtcaatgcaatggaaagaataagtcacgaatcaaatgtgcttttcttgtcttatacactttgtattggtagcttatag |
18845035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University