View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4404_high_13 (Length: 249)
Name: NF4404_high_13
Description: NF4404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4404_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 38564508 - 38564265
Alignment:
| Q |
1 |
aaattgagtaaatgaaaatgcaaagattaatacttcatttgtttataaacatgtgcgaacgttcataatctcaatatatatctgactgatcaggaatttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38564508 |
aaattgagtaaatgaaaatgcaaagattaatacttcatttgtttataaacatgtgcgaacgttcataatctcaatatatatctgactgatcaggaatttg |
38564409 |
T |
 |
| Q |
101 |
aatgagacaaatgcagaggatgttgcttaacgcatttgccatataccactcgttcattagggacccttgtgaccggtgtgattgggtgcacgtgatgcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38564408 |
aatgagacaaatgcagaggatgttgcttaacgcatttgccatataccactcgttcattagggacccttgtgaccggtgtgattgggtgcacgtgatgcta |
38564309 |
T |
 |
| Q |
201 |
atgcatacataaaccaaattcacctttgagttgagtataatcta |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38564308 |
atgcatacataaaccaaattcacctttgagttgagtatgatcta |
38564265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 107 - 198
Target Start/End: Original strand, 34692131 - 34692224
Alignment:
| Q |
107 |
acaaatgcagaggatgttgcttaacgcatttgccatataccactcgt--tcattagggacccttgtgaccggtgtgattgggtgcacgtgatgc |
198 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| || ||||| || || ||||||||||| ||||| ||||||| ||||||||||||| |
|
|
| T |
34692131 |
acaaatgcagaggatgttgcttaaagcatttgccaaatgccacttgttctcgttagggaccctcgtgactggtgtgagcatgtgcacgtgatgc |
34692224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University