View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4404_low_23 (Length: 204)
Name: NF4404_low_23
Description: NF4404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4404_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 186
Target Start/End: Complemental strand, 55630796 - 55630626
Alignment:
| Q |
16 |
gaagatgcgtttgattttgataataatgatgatcgtgattttgagtggtatgattatgaggagaaaaaggatatattgaaagagatttttggtggtgatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55630796 |
gaagatgcgtttgattttgataataatgatgatcgtgattttgagtggtatgattatgaggagaaaaaggatatattgaaagagatttttggtggtgatt |
55630697 |
T |
 |
| Q |
116 |
atgattttgtgaaggaaaaaattagaagagaggttgaacttgccattcaaattgttggcggtgataagtct |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
55630696 |
atgattttgtgaaggaaaaaattagaagagaggttgaacttgccattcaagttgttggcggtgataagtct |
55630626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 46 - 105
Target Start/End: Complemental strand, 55616073 - 55616014
Alignment:
| Q |
46 |
gatcgtgattttgagtggtatgattatgaggagaaaaaggatatattgaaagagattttt |
105 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| | ||| ||| |||||||||||||| |
|
|
| T |
55616073 |
gatcgtgattttgagtggtatgattacgaggagaagagggagatactgaaagagattttt |
55616014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 46 - 105
Target Start/End: Complemental strand, 55623377 - 55623318
Alignment:
| Q |
46 |
gatcgtgattttgagtggtatgattatgaggagaaaaaggatatattgaaagagattttt |
105 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| | ||| ||| |||||||||||||| |
|
|
| T |
55623377 |
gatcgtgattttgagtggtatgattacgaggagaagagggagatactgaaagagattttt |
55623318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University