View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4405-Insertion-23 (Length: 205)
Name: NF4405-Insertion-23
Description: NF4405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4405-Insertion-23 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 8 - 205
Target Start/End: Original strand, 46795368 - 46795565
Alignment:
| Q |
8 |
gttacttggtttgtcaaactctaacatatcttgaagatcaaagaactttcttgctatttcacttgacaatcttacccttctgtctctcaaaccctgtgat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795368 |
gttacttggtttgtcaaactctaacatatcttgaagatcaaagaactttcttgctatttcacttgacaatcttacccttctgtctctcaaaccctgtgat |
46795467 |
T |
|
| Q |
108 |
gtgtgaatcttactgtgcctatctttctttcctcctataactgttgctggttgtttctgctctgtcacaacaaaatttggaattggaaaactactagt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795468 |
gtgtgaatcttactgtgcctatctttctttcctcctataactgttgctggttgtttctgctctgtcacaacaaaatttggaattggaaaactactagt |
46795565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 12 - 136
Target Start/End: Complemental strand, 6032161 - 6032037
Alignment:
| Q |
12 |
cttggtttgtcaaactctaacatatcttgaagatcaaagaactttcttgctatttcacttgacaatcttacccttctgtctctcaaaccctgtgatgtgt |
111 |
Q |
| |
|
|||| |||||||||| ||||||| ||||||||||| |||||||| || || || || | || | ||| ||||||||||||||||| || || ||||||| |
|
|
| T |
6032161 |
cttgctttgtcaaaccctaacatgtcttgaagatcgaagaacttcctcgcgatctcgatggaaagtctcacccttctgtctctcaacccttgagatgtgt |
6032062 |
T |
|
| Q |
112 |
gaatcttactgtgcctatctttctt |
136 |
Q |
| |
|
||||||| || ||||| |||||||| |
|
|
| T |
6032061 |
gaatcttgctatgcctgtctttctt |
6032037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 57
Target Start/End: Complemental strand, 6711290 - 6711250
Alignment:
| Q |
17 |
tttgtcaaactctaacatatcttgaagatcaaagaactttc |
57 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| |||||||||| |
|
|
| T |
6711290 |
tttgtcaaaccctaacatgtcttgaagatcgaagaactttc |
6711250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University