View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4405-Insertion-25 (Length: 139)
Name: NF4405-Insertion-25
Description: NF4405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4405-Insertion-25 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 2e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 8 - 139
Target Start/End: Complemental strand, 41659607 - 41659478
Alignment:
| Q |
8 |
aatcagactttgatttcgtgatttattataagttataatyaattagtattattaaatataactatataggggctgatatgtatggtacaacaaccactcg |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
41659607 |
aatcaaactttgatttcgtgatttattataagttataatcaattagtattagtaa-tataactatag-ggggctgatatatatggtacaacaaccactcg |
41659510 |
T |
 |
| Q |
108 |
atttacatgttggaatggtttaaaaccgattt |
139 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |
|
|
| T |
41659509 |
atttacatgttggaatggtttaacaccgattt |
41659478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University