View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4405-Insertion-26 (Length: 128)
Name: NF4405-Insertion-26
Description: NF4405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4405-Insertion-26 |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 3e-55; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 8 - 128
Target Start/End: Complemental strand, 37277090 - 37276970
Alignment:
| Q |
8 |
ggcactaggtgcgggtgcaatattatcgaaggtacctgcaggcacgggtcctccaattggtcccgccacaatattgatgccgtttgctgatggaggatcc |
107 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37277090 |
ggcactaggtgcgggtgcaatattatcaaaggtacctgcatgcacgggtcctccaattggtcccgccacaatattgatgccgtttgctgaaggaggatcc |
37276991 |
T |
 |
| Q |
108 |
ccctttctagttccaacaaga |
128 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37276990 |
ccctttctagttccaacaaga |
37276970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 8 - 128
Target Start/End: Complemental strand, 37261349 - 37261235
Alignment:
| Q |
8 |
ggcactaggtgcgggtgcaatattatcgaaggtacctgcaggcacgggtcctccaattggtcccgccacaatattgatgccgtttgctgatggaggatcc |
107 |
Q |
| |
|
|||| |||||||||| ||| || ||||||||| ||| | |||||||||||| ||||| ||||||||||||||| ||| |||||| ||||||||| |
|
|
| T |
37261349 |
ggcattaggtgcgggcgcagtactatcgaaggcaccaggaggcacgggtccaccaatgggtcccgccacaata------ccgcctgctgaaggaggatcc |
37261256 |
T |
 |
| Q |
108 |
ccctttctagttccaacaaga |
128 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
37261255 |
ccgcttctagttccaacaaga |
37261235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 128
Target Start/End: Complemental strand, 37265122 - 37265008
Alignment:
| Q |
8 |
ggcactaggtgcgggtgcaatattatcgaaggtacctgcaggcacgggtcctccaattggtcccgccacaatattgatgccgtttgctgatggaggatcc |
107 |
Q |
| |
|
|||| |||||||||| ||| || |||||||| ||| | |||||||||||| ||||| ||||||||||||||| || |||||| ||||||||| |
|
|
| T |
37265122 |
ggcattaggtgcgggcgcagtaccatcgaaggcacccggaggcacgggtccaccaatgggtcccgccacaata------ccacctgctgaaggaggatcc |
37265029 |
T |
 |
| Q |
108 |
ccctttctagttccaacaaga |
128 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
37265028 |
ccacttctagttccaacaaga |
37265008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University