View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4405_high_38 (Length: 224)
Name: NF4405_high_38
Description: NF4405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4405_high_38 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 35482259 - 35482482
Alignment:
| Q |
1 |
cgaacttgagttgcgactatgatacgattctgttcgacaccggtgatgccggtggtttcttcaagggtgggaggtgaaaagccttcacggaggagggaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35482259 |
cgaacttgagttgcgactatgatacgattctgttcgacaccggtgatgccggtggtttcttcaagggtgggaggtgaaaagccttcacggaggagggaag |
35482358 |
T |
|
| Q |
101 |
tgatgagaggagcgtattcgtgccaggcaccgagacggttggcgaggatgtcaatgcgacctgggatgtcgaggttgtcgtattttgatggtagaggtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35482359 |
tgatgagaggagcgtattcgtgccaggcaccgagacggttggcgaggatgtcgatgcgacctgggatgtcgaggttgtcgtattttgatgggagaggtgt |
35482458 |
T |
|
| Q |
201 |
tggtggtggtcggaaaggttggta |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35482459 |
tggtggtggtcggaaaggttggta |
35482482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University