View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4405_low_10 (Length: 512)
Name: NF4405_low_10
Description: NF4405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4405_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 19 - 396
Target Start/End: Original strand, 15935756 - 15936133
Alignment:
| Q |
19 |
aactccgcttcgaggatgcgatctgcttcgccttcgttgaggttagaaagctttttgccgaggagctcgtataattcatcgtcggggagacgagatatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
15935756 |
aactccgcttcgaggatgcgatctgcttcgccttcggggaggttagaaagctttttgccgaggagctcgtataattcatcgtcggagagacgagatatta |
15935855 |
T |
|
| Q |
119 |
caaatttggggaggtaagggaccttgtttgccaatctgatggccacttgccgaatgagtgggtcgaacttttcgtccacgacgttgccggagccggaagc |
218 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15935856 |
caaatttggggaggtaagagaccttgtttgccaatctgatggccacttgccgaatgagcgggtcgaacttttcgtccacgacgttgccggagccggaagc |
15935955 |
T |
|
| Q |
219 |
catcctgtatctgtttgtgtttgtttagcaggcaggttaggttaggttacgtgatatttgagtatgagtatttaaccctactgttttggatataacaaac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15935956 |
catcctgtatctgtttgtgtttgtttagcaggcaggttaggttaagttacgtgatattttagtatgagtatttaaccctactgttttggatataacaaac |
15936055 |
T |
|
| Q |
319 |
nnnnnnnccctaattacgtgaagccgaacctaacacctcacccttaaaagcagccaatcaaatattttcaataattaa |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15936056 |
aaaaaaaccctaattacgtgaagccgaacctaacacctcacccttaaaagcagccaatcaaatattttcaataattaa |
15936133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University