View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4405_low_20 (Length: 387)
Name: NF4405_low_20
Description: NF4405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4405_low_20 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 192 - 387
Target Start/End: Original strand, 41077137 - 41077332
Alignment:
| Q |
192 |
tgatcctttgtcccgttattctataatcctaacaagaccttcatagtcaaagtgaagacttaaattgctcaaatctgtagcaacatggtgactggaacca |
291 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077137 |
tgatcctttatcccgttattctataatcctaacaagaccttcatagtcaaagggaagacttaaattgctcaaatctgtagcaacatggtgactggaacca |
41077236 |
T |
 |
| Q |
292 |
atattttgtaatgtcctggaaattaaagtcacagttggcagtggatggtttgattgagagttgcaatgtctcgatctttgatagaaagagcgatgt |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077237 |
atattttgtaatgtcctggaaattaaagtcacagttggcagtggatggtttgattgagagttgcaatgtctcgatctttgatagaaagagcgatgt |
41077332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 16 - 114
Target Start/End: Original strand, 41076961 - 41077059
Alignment:
| Q |
16 |
cagaggtgagtggaaccagtgcgttctgttctgactaaaccggagccgtcttcaatggtaacagagtccagacctgttaggatatagaataaagaaaaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41076961 |
cagaggtgagtggaaccagtgcgttctgttctgactaaaccggagccgtcttcaatggtaacagagtccagacctgttaggatatagaataaagaaaaa |
41077059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University