View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4405_low_22 (Length: 364)
Name: NF4405_low_22
Description: NF4405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4405_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 19 - 108
Target Start/End: Complemental strand, 3585679 - 3585590
Alignment:
| Q |
19 |
ctaacatgcccataactccattttccaaaaagattacttttttccatccacattgttgtttcaaaaaatgggctggacataaatatcaac |
108 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3585679 |
ctaacatgcccacaactccattttccaaaaagattacttttttccatccacattattgtttcaaaaaatgggctggacataaatatcaac |
3585590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 233 - 262
Target Start/End: Complemental strand, 3585465 - 3585436
Alignment:
| Q |
233 |
gaacgtgtaccttgttattgatgatgttgt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3585465 |
gaacgtgtaccttgttattgatgatgttgt |
3585436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University