View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4405_low_25 (Length: 356)
Name: NF4405_low_25
Description: NF4405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4405_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 7e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 161 - 338
Target Start/End: Complemental strand, 17896903 - 17896726
Alignment:
| Q |
161 |
cttgattattttatctgagagaaaagaggattgggtctttttctctannnnnnnctggcttttgaattagttaaaatatatataattcatttatttcttg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17896903 |
cttgattattttatctgagagaaaagaggattgggtctttttctctatttttttctggcttttgaattagttaaaatatatataattcatttttttcttg |
17896804 |
T |
 |
| Q |
261 |
ttggtgaccggaatgtgccggtgggggattgaacggaagaaaatgtgacggcggaggaagggaggaccttgtcggaga |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
17896803 |
ttggtgaccggaatgtgccggtgggggattgaacggaagaaaatgtgtcggcggaggaagggaggaccgggtcggaga |
17896726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University