View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4405_low_25 (Length: 356)

Name: NF4405_low_25
Description: NF4405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4405_low_25
NF4405_low_25
[»] chr4 (1 HSPs)
chr4 (161-338)||(17896726-17896903)


Alignment Details
Target: chr4 (Bit Score: 141; Significance: 7e-74; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 161 - 338
Target Start/End: Complemental strand, 17896903 - 17896726
Alignment:
161 cttgattattttatctgagagaaaagaggattgggtctttttctctannnnnnnctggcttttgaattagttaaaatatatataattcatttatttcttg 260  Q
    |||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||| |||||||    
17896903 cttgattattttatctgagagaaaagaggattgggtctttttctctatttttttctggcttttgaattagttaaaatatatataattcatttttttcttg 17896804  T
261 ttggtgaccggaatgtgccggtgggggattgaacggaagaaaatgtgacggcggaggaagggaggaccttgtcggaga 338  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||  ||||||||    
17896803 ttggtgaccggaatgtgccggtgggggattgaacggaagaaaatgtgtcggcggaggaagggaggaccgggtcggaga 17896726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University