View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4405_low_27 (Length: 345)
Name: NF4405_low_27
Description: NF4405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4405_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 235 - 339
Target Start/End: Original strand, 33499795 - 33499899
Alignment:
| Q |
235 |
gaactcatttcagcattgtacattccccacttctcactctgttgggacacttgaataaatcctatctacattaatcaaccacacccctcaacataattca |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
33499795 |
gaactcatttcagcattgtacattccccacgtctcactctgttgggacacttgaataaatcctatctacagtaatcaaccacaccccttaacataattca |
33499894 |
T |
|
| Q |
335 |
tctca |
339 |
Q |
| |
|
||||| |
|
|
| T |
33499895 |
tctca |
33499899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 38 - 182
Target Start/End: Original strand, 33499580 - 33499732
Alignment:
| Q |
38 |
atatattctattttgacttgttnnnnnnnntcaatcaattcaaatgagatgtcatgtcaatgttttggcactctagcttagttaattttgttctcaactc |
137 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
33499580 |
atatattctattttaacttgttagaaaaaatcaatcaattcaaatgagatgtcatgtcaatgttttggcgctctagcttagttaattttgctctcaactc |
33499679 |
T |
|
| Q |
138 |
cgtcgaagagggacctcctt--------gtgtctactattatgagtttccaat |
182 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33499680 |
cgtcgaagagggacctccttgtatttaagtgtctactattatgagtttccaat |
33499732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University