View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4405_low_29 (Length: 331)
Name: NF4405_low_29
Description: NF4405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4405_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 11 - 316
Target Start/End: Complemental strand, 37557928 - 37557623
Alignment:
| Q |
11 |
catcactcaagacctataaagaaatgaacataaaacaggctaaattatgagtaacttgtttcatgaatagcaacatgtcatggagtttatcaatcacaga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37557928 |
catcactcaagacctataaagaaatgaacataaaacaggctaaattatgagtaacttgtttcatgaatagcaacatgtcatggagtttatcaatcacaga |
37557829 |
T |
|
| Q |
111 |
ttctttttgattttgcagagaacatattagattagatttgaagccagaatgaattacctgctgaacaagttcctgggcacaacttttggcttcttctggt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37557828 |
ttctttttgattttgcagagaacatattagattagatttgaagccagaatgaattacctgctgaacaagttcctgggcacaacttttggcttcttctggt |
37557729 |
T |
|
| Q |
211 |
tgctccgaatttctcatctcaagacatgtgaaattcaagatagcattatgtcgagcaaacatccttgctacgggacggtatccatctctatcacttaagt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37557728 |
tgctccgaatttctcatctcaagacatgtgaaattcaagatagcattatgtcgagcgaacatccttgctacgggacggtatccatctctatcacttaagt |
37557629 |
T |
|
| Q |
311 |
tgtaat |
316 |
Q |
| |
|
|||||| |
|
|
| T |
37557628 |
tgtaat |
37557623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University