View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4405_low_35 (Length: 276)
Name: NF4405_low_35
Description: NF4405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4405_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 20 - 154
Target Start/End: Complemental strand, 4405720 - 4405586
Alignment:
| Q |
20 |
actaatccagaaattgttaacatatggaagaattgtacctgggcttgaaggaattggtcaatttcatccttttgttgtttgatttgtgaagctaaaccat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4405720 |
actaatccagaaattgttaacatatggaagaattgtacctgggcttgaaggaattggtcaatttcatctttttgttgtttgatttgtgaagctaaaccat |
4405621 |
T |
|
| Q |
120 |
ttgacaatagagacaagaaatgagaggaatgacac |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4405620 |
ttgacaatagagacaagaaatgagaggaatgacac |
4405586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 202 - 267
Target Start/End: Complemental strand, 4405547 - 4405482
Alignment:
| Q |
202 |
atcaccaaaggataaacctaaacctgtagaaacaatgttttgattctgttgttgttgatgatgatg |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4405547 |
atcaccaaaggataaacctaaacctgtagaaacaatgttttgattctgttgttgttgatgatgatg |
4405482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University