View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4405_low_38 (Length: 254)
Name: NF4405_low_38
Description: NF4405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4405_low_38 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 21 - 254
Target Start/End: Complemental strand, 1561675 - 1561442
Alignment:
| Q |
21 |
tggaacactttttgcatcattattggagacgcggtgaaaaaagcagaattatttagatatattagtatagccccagaaacacagtaagatattatataag |
120 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1561675 |
tggaacactttttgtatcattattggagacgcggtgaaaaaagcagaattatttagatatattagtatagccccagaaacacagtaagatattatataag |
1561576 |
T |
 |
| Q |
121 |
aacaaaaaagtcatgccttttcctagaagatagggttggttacatggatcacttaatgccataaattcttgtcaagcactagatccaacgatagaccatt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1561575 |
aacaaaaaagtcatgccttttcctagaagatagggttggttacatggatcacttaatgccataaattcttgtcaagcactagatccaacgatagaccatt |
1561476 |
T |
 |
| Q |
221 |
tagatttaaattgctccaagatggaccaagatac |
254 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
1561475 |
tagatttaaattgctctaagatggaccaagatac |
1561442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University