View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4405_low_40 (Length: 243)
Name: NF4405_low_40
Description: NF4405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4405_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 21 - 229
Target Start/End: Original strand, 25102240 - 25102450
Alignment:
| Q |
21 |
cctgtagtacgttaaatttgggcaagggtctagaataaatttttaatctccgatagcaacacaacaccaaaaatatctgatagaaacaacatagtgacgg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25102240 |
cctgtagtacgttaaatttgggcaagggtctagaataaatttttaatctccaatagcaacacaacaccaaaaatatctgatagaaacaagatagtgacgg |
25102339 |
T |
 |
| Q |
121 |
cagtggatgcaaaagaacagattaataaaactaattaaacattaaacactttatttaatttattttaattcagcaa--ttgattttagtatgtcacgtga |
218 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
25102340 |
cagtggatgcaaaagaacaaattaataaaactaattaaacattaaatactttatttaatttattttaattcagcaattttgtttttagtatgtcacgtga |
25102439 |
T |
 |
| Q |
219 |
cgtagaataat |
229 |
Q |
| |
|
||||||||||| |
|
|
| T |
25102440 |
cgtagaataat |
25102450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University