View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4406-Insertion-10 (Length: 298)
Name: NF4406-Insertion-10
Description: NF4406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4406-Insertion-10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 8 - 164
Target Start/End: Original strand, 36534406 - 36534564
Alignment:
| Q |
8 |
ttgagagctacttcttcctttccattgcgtcccctctccactatgtgattgcatataattctccccagcactgctatatggcacgacatgccattcgttg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534406 |
ttgagagctacttcttcctttccattgcgtcccctctccactatgtgattgcatataattctcaccagcactgctatatggcacgacatgccattcgttg |
36534505 |
T |
|
| Q |
108 |
aatctgcacgagcgcttaattttagtcacttgcttggcttataaa--ttcacttttcat |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36534506 |
aatctgcacgagcgcttaattttagtcacttgcttggcttataaattttcacttttcat |
36534564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 150 - 180
Target Start/End: Original strand, 36534582 - 36534612
Alignment:
| Q |
150 |
aaattcacttttcatcatgattgttttggtc |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36534582 |
aaattcacttttcatcatgattgttttggtc |
36534612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University