View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4406-Insertion-10 (Length: 298)

Name: NF4406-Insertion-10
Description: NF4406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4406-Insertion-10
NF4406-Insertion-10
[»] chr1 (2 HSPs)
chr1 (8-164)||(36534406-36534564)
chr1 (150-180)||(36534582-36534612)


Alignment Details
Target: chr1 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 8 - 164
Target Start/End: Original strand, 36534406 - 36534564
Alignment:
8 ttgagagctacttcttcctttccattgcgtcccctctccactatgtgattgcatataattctccccagcactgctatatggcacgacatgccattcgttg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
36534406 ttgagagctacttcttcctttccattgcgtcccctctccactatgtgattgcatataattctcaccagcactgctatatggcacgacatgccattcgttg 36534505  T
108 aatctgcacgagcgcttaattttagtcacttgcttggcttataaa--ttcacttttcat 164  Q
    |||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||    
36534506 aatctgcacgagcgcttaattttagtcacttgcttggcttataaattttcacttttcat 36534564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 150 - 180
Target Start/End: Original strand, 36534582 - 36534612
Alignment:
150 aaattcacttttcatcatgattgttttggtc 180  Q
    |||||||||||||||||||||||||||||||    
36534582 aaattcacttttcatcatgattgttttggtc 36534612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University